lenticrisprv2 construct Search Results


94
Addgene inc lenticrisprv2 hygro
Lenticrisprv2 Hygro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrisprv2 hygro/product/Addgene inc
Average 94 stars, based on 1 article reviews
lenticrisprv2 hygro - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

90
Addgene inc lenticrisprv2-grna constructs
Lenticrisprv2 Grna Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrisprv2-grna constructs/product/Addgene inc
Average 90 stars, based on 1 article reviews
lenticrisprv2-grna constructs - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation cas9 third generation lentivirus construct (lenticrisprv2
Cas9 Third Generation Lentivirus Construct (Lenticrisprv2, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cas9 third generation lentivirus construct (lenticrisprv2/product/GenScript corporation
Average 90 stars, based on 1 article reviews
cas9 third generation lentivirus construct (lenticrisprv2 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

96
Addgene inc sgrna expression
Figure 1. Systematic mapping of CDK gene function in triple negative breast cancer cells. (a) CDK proteins control cell-cycle progression and act as transcriptional regulators, garnering interest as potential drug targets (colors). (b) Schematic describing the combinatorial CRISPR/Cas9 fitness screening approach to map CDK synthetic-lethal and synergistic interactions. A library of dual <t>sgRNA</t> constructs targeting pairs of genes listed in (a) was synthesized as an oligonucleotide pool and cloned into <t>a</t> <t>lentiviral</t> overexpression vector (top). TNBC cell lines were transduced with virus coding for this library and subjected to competitive growth screening. Resulting dual sgRNA construct fitnesses were used to extract single gene fitness values and map genetic interactions. (c) Schematic describing the single-cell transcriptional phenotyping approach to map the functional impact of CDK genetic perturbations. An sgRNA library targeting the genes in (a) was cloned into an scRNA-seq-compatible lentiviral overexpression vector and used to transduce TNBC cell lines in pooled format. One week after transduction, scRNA-seq was performed using the 10x Chromium platform.
Sgrna Expression, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna expression/product/Addgene inc
Average 96 stars, based on 1 article reviews
sgrna expression - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

95
Addgene inc lenticrisprv2 plasmid

Lenticrisprv2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrisprv2 plasmid/product/Addgene inc
Average 95 stars, based on 1 article reviews
lenticrisprv2 plasmid - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

96
Addgene inc itch knockout cell lines

Itch Knockout Cell Lines, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/itch knockout cell lines/product/Addgene inc
Average 96 stars, based on 1 article reviews
itch knockout cell lines - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

98
Addgene inc lenticrisprv2 constructs
A : The deletion in the U3 region of the SIN LTR vector <t>(lentiCRISPRv2)</t> was repaired by inserting the full-length HIV-1 LAI LTR sequence to create the HIV-CRISPR construct. B : The ISG-targeting sgRNA library (15,348 unique sgRNA sequences) was synthesized and assembled into the HIV-CRISPR backbone to create the PIKA HIV ( P ackageable I SG K nockout A ssembly) library. C : THP-1 cells containing the PIKA HIV CRISPR knockout library were stimulated overnight with 1000 U/mL IFNα and infected with HIV-1 LAI in duplicate infections. Viral RNA and genomic DNA were collected 3 days post infection and sgRNA sequences present in virions (vRNA) and genomic DNA (gDNA) were quantified through RT-PCR/PCR and deep sequencing. D : Average enrichment of sgRNA sequences in the viral RNA (vRNA) was compared to their representation in the sequenced genomic DNA (gDNA) (n=2). Y-Axis : Log 2 -normalized Fold Change (log 2 FC) of vRNA sgRNA sequences as compared to gDNA sgRNA sequences. X-Axis : random order of individual sgRNAs. The 200 non-targeting control (NTC) sgRNAs are shown in gray. The most enriched sgRNA sequences are in cyan (top 500), most depleted in orange (bottom 500) and other sgRNA sequences are in white. E : MAGeCK Gene analysis was performed to identify the highest-scoring genes based on sgRNA frequencies for each gene across both replicates. An NTC gene set was created in silico by iteratively binning the 200 Non-Targeting Control sgRNA sequences into NTC Genes. Y-Axis : −log 10 MAGeCK Gene Score. The type I IFN pathway genes IFNAR1, IRF9, STAT1 and STAT2 are shown in magenta. Non-Targeting Controls (NTCs) are in gray. Candidate Hits are cyan. The top 20-scoring genes across replicate screens are shown.
Lenticrisprv2 Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrisprv2 constructs/product/Addgene inc
Average 98 stars, based on 1 article reviews
lenticrisprv2 constructs - by Bioz Stars, 2026-03
98/100 stars
  Buy from Supplier

95
Addgene inc lentiviral mcherry construct
Separated images of whole protein stain (left) and DDK-tagged RTFDC1 (right) from immunoblot in ( RTFDC1 <t>lentiviral</t> overexpression system). Each lane represents a different lentiviral transduction.
Lentiviral Mcherry Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral mcherry construct/product/Addgene inc
Average 95 stars, based on 1 article reviews
lentiviral mcherry construct - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

93
Addgene inc grna lenticrisprv2 construct
Separated images of whole protein stain (left) and DDK-tagged RTFDC1 (right) from immunoblot in ( RTFDC1 <t>lentiviral</t> overexpression system). Each lane represents a different lentiviral transduction.
Grna Lenticrisprv2 Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna lenticrisprv2 construct/product/Addgene inc
Average 93 stars, based on 1 article reviews
grna lenticrisprv2 construct - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

95
Addgene inc lenticrisprv2

Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrisprv2/product/Addgene inc
Average 95 stars, based on 1 article reviews
lenticrisprv2 - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

94
Addgene inc lenticrisprv2 addgene

Lenticrisprv2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrisprv2 addgene/product/Addgene inc
Average 94 stars, based on 1 article reviews
lenticrisprv2 addgene - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

98
Addgene inc lenticrispr v2 construct

Lenticrispr V2 Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrispr v2 construct/product/Addgene inc
Average 98 stars, based on 1 article reviews
lenticrispr v2 construct - by Bioz Stars, 2026-03
98/100 stars
  Buy from Supplier

Image Search Results


Figure 1. Systematic mapping of CDK gene function in triple negative breast cancer cells. (a) CDK proteins control cell-cycle progression and act as transcriptional regulators, garnering interest as potential drug targets (colors). (b) Schematic describing the combinatorial CRISPR/Cas9 fitness screening approach to map CDK synthetic-lethal and synergistic interactions. A library of dual sgRNA constructs targeting pairs of genes listed in (a) was synthesized as an oligonucleotide pool and cloned into a lentiviral overexpression vector (top). TNBC cell lines were transduced with virus coding for this library and subjected to competitive growth screening. Resulting dual sgRNA construct fitnesses were used to extract single gene fitness values and map genetic interactions. (c) Schematic describing the single-cell transcriptional phenotyping approach to map the functional impact of CDK genetic perturbations. An sgRNA library targeting the genes in (a) was cloned into an scRNA-seq-compatible lentiviral overexpression vector and used to transduce TNBC cell lines in pooled format. One week after transduction, scRNA-seq was performed using the 10x Chromium platform.

Journal: Scientific reports

Article Title: Multimodal perturbation analyses of cyclin-dependent kinases reveal a network of synthetic lethalities associated with cell-cycle regulation and transcriptional regulation.

doi: 10.1038/s41598-023-33329-2

Figure Lengend Snippet: Figure 1. Systematic mapping of CDK gene function in triple negative breast cancer cells. (a) CDK proteins control cell-cycle progression and act as transcriptional regulators, garnering interest as potential drug targets (colors). (b) Schematic describing the combinatorial CRISPR/Cas9 fitness screening approach to map CDK synthetic-lethal and synergistic interactions. A library of dual sgRNA constructs targeting pairs of genes listed in (a) was synthesized as an oligonucleotide pool and cloned into a lentiviral overexpression vector (top). TNBC cell lines were transduced with virus coding for this library and subjected to competitive growth screening. Resulting dual sgRNA construct fitnesses were used to extract single gene fitness values and map genetic interactions. (c) Schematic describing the single-cell transcriptional phenotyping approach to map the functional impact of CDK genetic perturbations. An sgRNA library targeting the genes in (a) was cloned into an scRNA-seq-compatible lentiviral overexpression vector and used to transduce TNBC cell lines in pooled format. One week after transduction, scRNA-seq was performed using the 10x Chromium platform.

Article Snippet: A lentiviral vector containing Cas9 and a human U6 promoter for sgRNA expression (LentiCRISPRv2: Addgene 52961) was digested with BsmBI (NEB R0580) for 3 h at 55 °C.

Techniques: Control, CRISPR, Construct, Synthesized, Clone Assay, Over Expression, Plasmid Preparation, Transduction, Virus, Functional Assay

Journal: Cell Reports

Article Title: De novo steroidogenesis in tumor cells drives bone metastasis and osteoclastogenesis

doi: 10.1016/j.celrep.2024.113936

Figure Lengend Snippet:

Article Snippet: The constructed lentiCRISPRv2 plasmid together with the packaging plasmids, psPAX2 (Addgene, 12260) and pMD2.G (Addgene, 12259) were transfected into HEK293T cells.

Techniques: Virus, shRNA, Recombinant, Modification, Staining, RNA Library Preparation, TaqMan Assay, Competitive ELISA, RNA Sequencing, Plasmid Preparation, Software, Real-time Polymerase Chain Reaction

A : The deletion in the U3 region of the SIN LTR vector (lentiCRISPRv2) was repaired by inserting the full-length HIV-1 LAI LTR sequence to create the HIV-CRISPR construct. B : The ISG-targeting sgRNA library (15,348 unique sgRNA sequences) was synthesized and assembled into the HIV-CRISPR backbone to create the PIKA HIV ( P ackageable I SG K nockout A ssembly) library. C : THP-1 cells containing the PIKA HIV CRISPR knockout library were stimulated overnight with 1000 U/mL IFNα and infected with HIV-1 LAI in duplicate infections. Viral RNA and genomic DNA were collected 3 days post infection and sgRNA sequences present in virions (vRNA) and genomic DNA (gDNA) were quantified through RT-PCR/PCR and deep sequencing. D : Average enrichment of sgRNA sequences in the viral RNA (vRNA) was compared to their representation in the sequenced genomic DNA (gDNA) (n=2). Y-Axis : Log 2 -normalized Fold Change (log 2 FC) of vRNA sgRNA sequences as compared to gDNA sgRNA sequences. X-Axis : random order of individual sgRNAs. The 200 non-targeting control (NTC) sgRNAs are shown in gray. The most enriched sgRNA sequences are in cyan (top 500), most depleted in orange (bottom 500) and other sgRNA sequences are in white. E : MAGeCK Gene analysis was performed to identify the highest-scoring genes based on sgRNA frequencies for each gene across both replicates. An NTC gene set was created in silico by iteratively binning the 200 Non-Targeting Control sgRNA sequences into NTC Genes. Y-Axis : −log 10 MAGeCK Gene Score. The type I IFN pathway genes IFNAR1, IRF9, STAT1 and STAT2 are shown in magenta. Non-Targeting Controls (NTCs) are in gray. Candidate Hits are cyan. The top 20-scoring genes across replicate screens are shown.

Journal: bioRxiv

Article Title: A Virus-Packageable CRISPR Screen Identifies Host Factors Mediating Interferon Inhibition of HIV

doi: 10.1101/363432

Figure Lengend Snippet: A : The deletion in the U3 region of the SIN LTR vector (lentiCRISPRv2) was repaired by inserting the full-length HIV-1 LAI LTR sequence to create the HIV-CRISPR construct. B : The ISG-targeting sgRNA library (15,348 unique sgRNA sequences) was synthesized and assembled into the HIV-CRISPR backbone to create the PIKA HIV ( P ackageable I SG K nockout A ssembly) library. C : THP-1 cells containing the PIKA HIV CRISPR knockout library were stimulated overnight with 1000 U/mL IFNα and infected with HIV-1 LAI in duplicate infections. Viral RNA and genomic DNA were collected 3 days post infection and sgRNA sequences present in virions (vRNA) and genomic DNA (gDNA) were quantified through RT-PCR/PCR and deep sequencing. D : Average enrichment of sgRNA sequences in the viral RNA (vRNA) was compared to their representation in the sequenced genomic DNA (gDNA) (n=2). Y-Axis : Log 2 -normalized Fold Change (log 2 FC) of vRNA sgRNA sequences as compared to gDNA sgRNA sequences. X-Axis : random order of individual sgRNAs. The 200 non-targeting control (NTC) sgRNAs are shown in gray. The most enriched sgRNA sequences are in cyan (top 500), most depleted in orange (bottom 500) and other sgRNA sequences are in white. E : MAGeCK Gene analysis was performed to identify the highest-scoring genes based on sgRNA frequencies for each gene across both replicates. An NTC gene set was created in silico by iteratively binning the 200 Non-Targeting Control sgRNA sequences into NTC Genes. Y-Axis : −log 10 MAGeCK Gene Score. The type I IFN pathway genes IFNAR1, IRF9, STAT1 and STAT2 are shown in magenta. Non-Targeting Controls (NTCs) are in gray. Candidate Hits are cyan. The top 20-scoring genes across replicate screens are shown.

Article Snippet: lentiCRISPRv2 plasmid was a gift from Feng Zhang (Addgene #52961). lentiCRISPRv2-mCherry was a gift from Agata Smogorzewska (Addgene # 99154). pMD2.G and psPAX2 were gifts from Didier Trono (Addgene #12259/12260). lentiCRISPRv2 constructs targeting genes of interest were cloned into BsmBI-digested lentiCRISPRv2 by annealing complementary oligos (Supplemental Table S5) with overhangs that allow directional cloning into lentiCRISPRv2.

Techniques: Plasmid Preparation, Sequencing, CRISPR, Construct, Synthesized, Knock-Out, Infection, Reverse Transcription Polymerase Chain Reaction, In Silico

A : Clonal MxB-KO THP-1 lines generated by transducing with an MxB-targeting sgRNA/lentiCRISPRv2 construct, selection and single-cell sorting. Western blot for MxB expression with and without IFNα stimulation overnight is shown for wild type (wt) THP-1 cells; MxB-KO clones were all IFNα treated overnight. Note: the lower molecular weight band in some lanes results from initiation at an internal Met codon that would not be predicted to have anti-HIV activity ( ; ). B : Nine individual clonal THP-1 lines (white/gray bars) along with 5 clonal THP-1 MxB-KO lines (pink bars) were pre-treated with IFNα overnight and infected with wt HIV-1 LAI . The percentage of cells expressing HIV p24gag was assayed 2 days post-infection by intracellular staining and flow cytometry (n = 3). Light bars = no IFN; Dark bars = overnight IFNα treatment prior to infection. C : The Fold Inhibition (%p24+ cells without IFN/%p24+ cells with IFNα) calculated for each clonal line for wt HIV-1 LAI infections from the data in Panel B. Controls = gray; MxB-KO = magenta. Dotted line at a Fold Inhibition of 1 = no IFN inhibition. D : Individual clonal control THP-1 lines (gray) along with MxB-KO clonal lines (magenta) were infected with VSV-G pseudotyped HIV both with and without IFNα pretreatment (n = 3). Fold Inhibition was calculated as in C. Dotted line: Fold Inhibition of 1 = no IFN inhibition. *p=0.0014 (unpaired t test). E : The PIKA HIV screen was performed in triplicate in wild type THP-1 cells. Y-Axis: IFN induction as determined by Differential Expression Analysis of microarray data in THP-1 cells (log 2 FoldChange). X-Axis: MAGeCK Gene Scores for Top 25 Hits. Magenta: IFN pathway genes (IFNAR1, STAT1, STAT2, IRF9). Cyan: highly-IFN induced, high-scoring candidate Hits. White: non-IFN induced genes including ZAP, N4BP1, and SLC35A2.

Journal: bioRxiv

Article Title: A Virus-Packageable CRISPR Screen Identifies Host Factors Mediating Interferon Inhibition of HIV

doi: 10.1101/363432

Figure Lengend Snippet: A : Clonal MxB-KO THP-1 lines generated by transducing with an MxB-targeting sgRNA/lentiCRISPRv2 construct, selection and single-cell sorting. Western blot for MxB expression with and without IFNα stimulation overnight is shown for wild type (wt) THP-1 cells; MxB-KO clones were all IFNα treated overnight. Note: the lower molecular weight band in some lanes results from initiation at an internal Met codon that would not be predicted to have anti-HIV activity ( ; ). B : Nine individual clonal THP-1 lines (white/gray bars) along with 5 clonal THP-1 MxB-KO lines (pink bars) were pre-treated with IFNα overnight and infected with wt HIV-1 LAI . The percentage of cells expressing HIV p24gag was assayed 2 days post-infection by intracellular staining and flow cytometry (n = 3). Light bars = no IFN; Dark bars = overnight IFNα treatment prior to infection. C : The Fold Inhibition (%p24+ cells without IFN/%p24+ cells with IFNα) calculated for each clonal line for wt HIV-1 LAI infections from the data in Panel B. Controls = gray; MxB-KO = magenta. Dotted line at a Fold Inhibition of 1 = no IFN inhibition. D : Individual clonal control THP-1 lines (gray) along with MxB-KO clonal lines (magenta) were infected with VSV-G pseudotyped HIV both with and without IFNα pretreatment (n = 3). Fold Inhibition was calculated as in C. Dotted line: Fold Inhibition of 1 = no IFN inhibition. *p=0.0014 (unpaired t test). E : The PIKA HIV screen was performed in triplicate in wild type THP-1 cells. Y-Axis: IFN induction as determined by Differential Expression Analysis of microarray data in THP-1 cells (log 2 FoldChange). X-Axis: MAGeCK Gene Scores for Top 25 Hits. Magenta: IFN pathway genes (IFNAR1, STAT1, STAT2, IRF9). Cyan: highly-IFN induced, high-scoring candidate Hits. White: non-IFN induced genes including ZAP, N4BP1, and SLC35A2.

Article Snippet: lentiCRISPRv2 plasmid was a gift from Feng Zhang (Addgene #52961). lentiCRISPRv2-mCherry was a gift from Agata Smogorzewska (Addgene # 99154). pMD2.G and psPAX2 were gifts from Didier Trono (Addgene #12259/12260). lentiCRISPRv2 constructs targeting genes of interest were cloned into BsmBI-digested lentiCRISPRv2 by annealing complementary oligos (Supplemental Table S5) with overhangs that allow directional cloning into lentiCRISPRv2.

Techniques: Generated, Construct, Selection, FACS, Western Blot, Expressing, Clone Assay, Molecular Weight, Activity Assay, Infection, Staining, Flow Cytometry, Inhibition, Microarray

A : THP-1 cell pools edited for gene targets of interest were created by transducing wild type THP-1 cells with lentiCRISPRv2 sgRNA constructs (2 different sgRNAs - for STAT1, STAT2, IRF9, MxB, TRIM5 and Tetherin, and 3 for IFITM1), selected for 2 weeks to allow gene knockout (see Supplemental Table 6 for analysis of gene knockout efficiency) and infected with HIV-1 LAI with and without IFNα pretreatment in triplicate (white bars = no IFNα, gray bars = +IFNα). The percentage of cells expressing HIV p24gag was assayed 2 days post-infection by intracellular staining and flow cytometry. NTC n=9. MxB_2 n=6. All other pools n=3. B : The Fold Inhibition (%p24+ cells without IFN/%p24+ cells with IFNα) is shown for each KO pool. Control (NTC) = gray; IFN pathway genes = magenta. MxB = Cyan. TRIM5 = Green. IFITM1 = Purple. Tetherin = Yellow. Cells pools with significantly reduced Fold Inhibition as compared to the NTC pools *p<0.05 (unpaired t test). C : Virus release from the clonal NTC (white/gray) or MxB-KO clones (pink) from as measured with a viral RT assay at 3 days post-infection with HIV-1 LAI with and without IFNα (light bars = no IFN; dark bars = IFNα). D : The Fold Inhibition (RT mU/mL without IFN/RT mU/mL with IFNα) calculated for each clonal line. Controls = gray; MxB-KO = magenta. Dotted line: Fold Inhibition of 1 = no IFN inhibition. E : THP-1 cell pools (NTC_1 and NTC_2 = gray; Tetherin-KO pools = blue) created by transduction with lentiCRISPRv2 lentiviral vectors were infected in triplicate with Vpu-deficient HIV (HIV-1 LAI Δvpu) or wild type HIV (wt HIV-1 LAI ). The HIV LAI Δvpu contains a frameshift mutation in Vpu upstream of the env open reading frame. IFNα was added 16 hours post-infection and T-20 fusion inhibitor was added 24 hours post-infection. The amount of reverse transcriptase (RT) activity released into the supernatant was then normalized to the percentage of p24+ cells in order to directly quantify virus release per infected cell in the presence of IFN (RT mU/mL/%p24+ cells in culture).

Journal: bioRxiv

Article Title: A Virus-Packageable CRISPR Screen Identifies Host Factors Mediating Interferon Inhibition of HIV

doi: 10.1101/363432

Figure Lengend Snippet: A : THP-1 cell pools edited for gene targets of interest were created by transducing wild type THP-1 cells with lentiCRISPRv2 sgRNA constructs (2 different sgRNAs - for STAT1, STAT2, IRF9, MxB, TRIM5 and Tetherin, and 3 for IFITM1), selected for 2 weeks to allow gene knockout (see Supplemental Table 6 for analysis of gene knockout efficiency) and infected with HIV-1 LAI with and without IFNα pretreatment in triplicate (white bars = no IFNα, gray bars = +IFNα). The percentage of cells expressing HIV p24gag was assayed 2 days post-infection by intracellular staining and flow cytometry. NTC n=9. MxB_2 n=6. All other pools n=3. B : The Fold Inhibition (%p24+ cells without IFN/%p24+ cells with IFNα) is shown for each KO pool. Control (NTC) = gray; IFN pathway genes = magenta. MxB = Cyan. TRIM5 = Green. IFITM1 = Purple. Tetherin = Yellow. Cells pools with significantly reduced Fold Inhibition as compared to the NTC pools *p<0.05 (unpaired t test). C : Virus release from the clonal NTC (white/gray) or MxB-KO clones (pink) from as measured with a viral RT assay at 3 days post-infection with HIV-1 LAI with and without IFNα (light bars = no IFN; dark bars = IFNα). D : The Fold Inhibition (RT mU/mL without IFN/RT mU/mL with IFNα) calculated for each clonal line. Controls = gray; MxB-KO = magenta. Dotted line: Fold Inhibition of 1 = no IFN inhibition. E : THP-1 cell pools (NTC_1 and NTC_2 = gray; Tetherin-KO pools = blue) created by transduction with lentiCRISPRv2 lentiviral vectors were infected in triplicate with Vpu-deficient HIV (HIV-1 LAI Δvpu) or wild type HIV (wt HIV-1 LAI ). The HIV LAI Δvpu contains a frameshift mutation in Vpu upstream of the env open reading frame. IFNα was added 16 hours post-infection and T-20 fusion inhibitor was added 24 hours post-infection. The amount of reverse transcriptase (RT) activity released into the supernatant was then normalized to the percentage of p24+ cells in order to directly quantify virus release per infected cell in the presence of IFN (RT mU/mL/%p24+ cells in culture).

Article Snippet: lentiCRISPRv2 plasmid was a gift from Feng Zhang (Addgene #52961). lentiCRISPRv2-mCherry was a gift from Agata Smogorzewska (Addgene # 99154). pMD2.G and psPAX2 were gifts from Didier Trono (Addgene #12259/12260). lentiCRISPRv2 constructs targeting genes of interest were cloned into BsmBI-digested lentiCRISPRv2 by annealing complementary oligos (Supplemental Table S5) with overhangs that allow directional cloning into lentiCRISPRv2.

Techniques: Construct, Gene Knockout, Infection, Expressing, Staining, Flow Cytometry, Inhibition, Clone Assay, Transduction, Mutagenesis, Activity Assay

Separated images of whole protein stain (left) and DDK-tagged RTFDC1 (right) from immunoblot in ( RTFDC1 lentiviral overexpression system). Each lane represents a different lentiviral transduction.

Journal: bioRxiv

Article Title: Variant-to-function mapping of late-onset Alzheimer’s disease GWAS signals in human microglial cell models implicates RTFDC1 at the CASS4 locus

doi: 10.1101/2024.08.22.609230

Figure Lengend Snippet: Separated images of whole protein stain (left) and DDK-tagged RTFDC1 (right) from immunoblot in ( RTFDC1 lentiviral overexpression system). Each lane represents a different lentiviral transduction.

Article Snippet: CRISPR-Cas9 mediated deletion of the approximately 400bp region surrounding the proxy SNP (rs6024870) at the CASS4 GWAS locus was achieved using a pooled lentiviral mCherry construct (lentiCRISPR v2-mCherry, Addgene 99154) containing one sgRNA on each side of the target region. sgRNAs were designed with CRISPOR , purchased from Integrated DNA Technologies, and cloned into the lentiCRISPR v2-mCherry plasmid by modified Golden Gate reaction – .

Techniques: Staining, Western Blot, Over Expression, Transduction

(A) Same as for IL-8 secretion, but including mock lentiviral overexpression vector (LentiMock) in the analysis. ** P <0.001 by one-way ANOVA with Tukey’s HSD. (B) Same as for IL-6 secretion, but including mock lentiviral overexpression vector (LentiMock) in the analysis. One-way ANOVA with Tukey’s HSD.

Journal: bioRxiv

Article Title: Variant-to-function mapping of late-onset Alzheimer’s disease GWAS signals in human microglial cell models implicates RTFDC1 at the CASS4 locus

doi: 10.1101/2024.08.22.609230

Figure Lengend Snippet: (A) Same as for IL-8 secretion, but including mock lentiviral overexpression vector (LentiMock) in the analysis. ** P <0.001 by one-way ANOVA with Tukey’s HSD. (B) Same as for IL-6 secretion, but including mock lentiviral overexpression vector (LentiMock) in the analysis. One-way ANOVA with Tukey’s HSD.

Article Snippet: CRISPR-Cas9 mediated deletion of the approximately 400bp region surrounding the proxy SNP (rs6024870) at the CASS4 GWAS locus was achieved using a pooled lentiviral mCherry construct (lentiCRISPR v2-mCherry, Addgene 99154) containing one sgRNA on each side of the target region. sgRNAs were designed with CRISPOR , purchased from Integrated DNA Technologies, and cloned into the lentiCRISPR v2-mCherry plasmid by modified Golden Gate reaction – .

Techniques: Over Expression, Plasmid Preparation

(A) Table displaying number of fluorescent nuclei quantified for each genotype and condition in the γH2AX staining experiment. (B) Same as , but including non-targeting siRNA control (NTControl) in the analysis. ** P <2.2×10 −16 by two-way ANOVA (genotype by condition) with Tukey’s HSD. (C) Same as , but including mock lentiviral overexpression vector (LentiMock) in the analysis. ** P <2.2×10 −16 by two-way ANOVA with Tukey’s HSD.

Journal: bioRxiv

Article Title: Variant-to-function mapping of late-onset Alzheimer’s disease GWAS signals in human microglial cell models implicates RTFDC1 at the CASS4 locus

doi: 10.1101/2024.08.22.609230

Figure Lengend Snippet: (A) Table displaying number of fluorescent nuclei quantified for each genotype and condition in the γH2AX staining experiment. (B) Same as , but including non-targeting siRNA control (NTControl) in the analysis. ** P <2.2×10 −16 by two-way ANOVA (genotype by condition) with Tukey’s HSD. (C) Same as , but including mock lentiviral overexpression vector (LentiMock) in the analysis. ** P <2.2×10 −16 by two-way ANOVA with Tukey’s HSD.

Article Snippet: CRISPR-Cas9 mediated deletion of the approximately 400bp region surrounding the proxy SNP (rs6024870) at the CASS4 GWAS locus was achieved using a pooled lentiviral mCherry construct (lentiCRISPR v2-mCherry, Addgene 99154) containing one sgRNA on each side of the target region. sgRNAs were designed with CRISPOR , purchased from Integrated DNA Technologies, and cloned into the lentiCRISPR v2-mCherry plasmid by modified Golden Gate reaction – .

Techniques: Staining, Control, Over Expression, Plasmid Preparation

Journal: eLife

Article Title: Proteomic landscape of tunneling nanotubes reveals CD9 and CD81 tetraspanins as key regulators

doi: 10.7554/eLife.99172

Figure Lengend Snippet:

Article Snippet: Transfected construct ( H. sapiens ) , lentiCRISPRv2 targeting human CD9 , CD9 target: GAATCGGAGCCATAGTCCAA , lentiCRISPRv2: Addgene #52961 , Lentiviral vector.

Techniques: Transfection, Construct, Expressing, Plasmid Preparation, Marker, Sequencing, Purification, Transduction, Control, Software, Staining